[Date Prev][Date Next][Thread Prev][Thread Next][Date Index][Thread Index]

Re: [Omaha.pm] BioPerl on FLOSS Weekly



On Nov 2, 2009, at 2:06 PM, Todd Christopher Hamilton wrote:
Ah well. Jay pointed me to some stuff he is doing but I am not smart enough to understand so I've go that going for me.

If I can do BioPerl, anybody can. There's just a lot of biology / chemistry buzzwordiness thrown around. After that it's just a bunch of scalars, arrays, and hashes. :)

j
>CR936259 Natronomonas pharaonis DSM 2160 plasmid PL23 complete genome.
GCGTGACTGAAGACTTAGAGTTTGCGGTCGAGACGGACTGAAAACCCAGAACGGGATTGA
AACATTACGGCGAATGGACGCTCGATATGACGTTTGACGATGTCGAGACGGACTGAAAAC
CCAGAACGGGATTGAAACGTTGCGGTCGACGATTCAGGCGACCAACTCGAACGTCGA...